Renilla luciferase (RLuc)

Classic intracellular bioluminescent enzyme from the sea pansy Renilla reniformis with 34 kDa size and blue emission at 480 nm. Standard normalization control in dual-luciferase reporter assays, providing constitutive internal reference for transfection efficiency and cell lysis recovery in mammalian expression studies.

Length: 936 bp(312 aa)

Emission: 480 nm

Substrate: Coelenterazine

Brightness: Moderate

Signal duration: Flash (<1 min)

Origin: Renilla reniformis

Characteristics

314-amino acid protein (34 kDa) catalyzes coelenterazine oxidation producing blue bioluminescence with peak emission at 480 nm. Energy transfer to endogenous Renilla GFP shifts emission to green (509 nm) in native organism. Recombinant expression in E. coli and mammalian cells produces functionally equivalent enzyme without requiring N-linked glycosylation for catalytic activity. Remains strictly intracellular unlike secreted luciferases such as Metridia luciferase. Stable enzymatic activity across pH and temperature ranges typical of mammalian cell culture. Lower specific activity than firefly luciferase but provides orthogonal substrate specificity enabling dual-reporter systems.

Applications: Standard internal control for dual-luciferase reporter assays normalizing firefly luciferase measurements to transfection efficiency and sample recovery. Constitutive expression from control promoters (CMV, HSV-TK, SV40) enables quantitative normalization across experimental conditions. Orthogonal substrate specificity with coelenterazine permits sequential measurements in the same sample using Promega Dual-Luciferase Reporter Assay System. BRET (bioluminescence resonance energy transfer) donor for protein-protein interaction studies with fluorescent protein acceptors. High-throughput screening applications requiring normalized readouts. Bicistronic expression constructs with IRES elements for simultaneous reporter and normalization control.

Limitations: Blue emission at 480 nm provides poor tissue penetration for in vivo imaging applications. Lower specific activity and brightness compared to firefly luciferase, NanoLuc, or Metridia luciferase requires higher expression levels for equivalent signal. Coelenterazine substrate has higher background autoluminescence and lower cell permeability than D-luciferin or furimazine. Flash-type kinetics with faster signal decay than firefly luciferase necessitates rapid measurement protocols. Intracellular localization requires cell lysis for detection, preventing non-destructive longitudinal assays on the same cells.

Sequence

atgacttcgaaagtttatgatccagaacaaaggaaacggatgataactggtccgcagtggtgggccagatgtaaacaaatgaatgttcttgattcatttattaattattatgattcagaaaaacatgcagaaaatgctgttatttttttacatggtaacgcggcctcttcttatttatggcgacatgttgtgccacatattgagccagtagcgcggtgtattataccagaccttattggtatgggcaaatcaggcaaatctggtaatggttcttataggttacttgatcattacaaatatcttactgcatggtttgaacttcttaatttaccaaagaagatcatttttgtcggccatgattggggtgcttgtttggcatttcattatagctatgagcatcaagataagatcaaagcaatagttcacgctgaaagtgtagtagatgtgattgaatcatgggatgaatggcctgatattgaagaagatattgcgttgatcaaatctgaagaaggagaaaaaatggttttggagaataacttcttcgtggaaaccatgttgccatcaaaaatcatgagaaagttagaaccagaagaatttgcagcatatcttgaaccattcaaagagaaaggtgaagttcgtcgtccaacattatcatggcctcgtgaaatcccgttagtaaaaggtggtaaacctgacgttgtacaaattgttaggaattataatgcttatctacgtgcaagtgatgatttaccaaaaatgtttattgaatcggacccaggattcttttccaatgctattgttgaaggtgccaagaagtttcctaatactgaatttgtcaaagtaaaaggtcttcatttttcgcaagaagatgcacctgatgaaatgggaaaatatatcaaatcgttcgttgagcgagttctcaaaaatgaacaataa

You must be signed in to view the full sequence.

References

Lorenz et al. (1991). Isolation and expression of a cDNA encoding Renilla reniformis luciferase. Proc Natl Acad Sci USA - Lorenz 1991 Renilla Luciferase