NanoLuc Luciferase (NanoLuc)

Engineered 19 kDa luciferase derived from the deep-sea shrimp Oplophorus gracilirostris with 150-fold higher specific activity than firefly or Renilla luciferases. Uses the synthetic substrate furimazine to produce bright, sustained glow-type bioluminescence, enabling highly sensitive reporter assays and protein interaction studies at very low expression levels.

Length: 516 bp(172 aa)

Emission: 460 nm

Substrate: Furimazine

Brightness: Very High

Signal duration: Glow (hours)

Origin: Directed evolution from Oplophorus gracilirostris luciferase subunit (19 kDa)

Characteristics

171 aa (513 bp CDS), 2.5 million-fold brighter than wild-type Oplophorus luciferase and 150-fold higher specific activity than firefly or Renilla luciferases. Generated by 16 amino acid substitutions through three phases of random mutagenesis and rational design. Uses furimazine substrate (Km ~10 μM) which is 25–30× brighter than native coelenterazine with low autoluminescence background. Produces glow-type signal with >2 hour half-life at room temperature. PEST-tagged variant (NanoLuc-PEST) has a 20-minute intracellular half-life for rapid response assays. Secreted form retains activity in culture medium for 15+ hours at 37°C.

Applications

Sensitive transcriptional reporter assays with 80× higher signal than firefly luciferase, enabling detection at minimal expression levels. Bioluminescence resonance energy transfer (BRET) with fluorescent protein acceptors for protein interaction studies. Real-time monitoring of protein translocation and stabilization (e.g., p53 DNA damage response). In vivo bioluminescence imaging with better depth penetration than FLuc at 460 nm emission. Dual reporter assays combined with orthogonal substrates.

Limitations

Emission peak at 460 nm (blue) provides less tissue penetration depth than red-shifted luciferases (e.g., CBR2, AkaLumine) for deep in vivo imaging. Requires furimazine substrate, which has higher cost than D-luciferin. Blue emission overlaps with common fluorescent proteins in multiplexed assays. Not interchangeable with FLuc or RLuc in legacy assay systems without substrate change.

Sequence

atggtcttcacactcgaagatttcgttggggactggcgacagacagccggctacaacctggaccaagtccttgaacagggaggtgtgtccagtttgtttcagaatctcggggtgtccgtaactccgatccaaaggattgtcctgagcggtgaaaatgggctgaagatcgacatccatgtcatcatcccgtatgaaggtctgagcggcgaccaaatgggccagatcgaaaaaatttttaaggtggtgtaccctgtggatgatcatcactttaaggtgatcctgcactatggcacactggtaatcgacggggttacgccgaacatgatcgactatttcggacggccgtatgaaggcatcgccgtgttcgacggcaaaaagatcactgtaacagggaccctgtggaacggcaacaaaattatcgacgagcgcctgatcaaccccgacggctccctgctgttccgagtaaccatcaacggagtgaccggctggcggctgtgcgaacgcattctggcgtaa

Literature References

  1. Hall et al. (2012). Engineered luciferase reporter from a deep sea shrimp utilizing a novel imidazopyrazinone substrate. ACS Chem Biol - Hall 2012 Nanoluc