Humanized renilla luciferase (hRluc)

Codon-optimized renilla luciferase engineered for enhanced protein expression in mammalian cells through synthetic gene design with preferred human codons. Maintains identical enzymatic properties to wild-type renilla luciferase while achieving 2-10× higher expression levels, enabling more sensitive reporter assays with lower DNA transfection amounts for dual-luciferase normalization protocols.

Length: 936 bp(312 aa)

Emission: 480 nm

Substrate: Coelenterazine

Brightness: Moderate

Signal duration: Flash (<1 min)

Origin: Codon optimization from Renilla reniformis

Characteristics

Synthetic gene encoding the 314-amino acid (36 kDa) renilla luciferase enzyme with optimized codon usage for mammalian translation machinery. Catalyzes identical coelenterazine oxidation reaction as wild-type enzyme producing blue bioluminescence with peak emission at 480 nm. Achieves 2-10× higher steady-state protein levels in HEK293, CHO, and other mammalian cell lines compared to native renilla sequence without altering enzymatic kinetics or substrate specificity. Retains strict intracellular localization requiring cell lysis for detection. Compatible with all standard renilla luciferase assay protocols and substrates. Enables lower plasmid DNA amounts (5-10 ng vs 50-100 ng) for equivalent normalization signal in dual-reporter experiments.

Applications: Internal control for dual-luciferase reporter assays with improved signal-to-background ratio enabling more precise normalization of firefly luciferase measurements. Standard component of Promega pRL vectors (pRL-TK, pRL-CMV, pRL-SV40) for constitutive expression-based normalization. Enhanced sensitivity allows detection in high-throughput screening applications with miniaturized assay volumes. Protein-protein interaction studies via BRET with reduced expression construct requirements. Quantitative gene expression analysis requiring robust internal controls across variable transfection efficiencies.

Limitations: Blue emission at 480 nm provides poor tissue penetration for in vivo imaging applications identical to wild-type renilla. Lower specific activity than NanoLuc or firefly luciferase requires higher absolute expression levels despite improved codon usage. Coelenterazine substrate exhibits higher background autoluminescence and cell permeability limitations compared to D-luciferin or furimazine. Flash-type kinetics with rapid signal decay necessitates immediate measurement protocols. Intracellular localization prevents non-destructive longitudinal monitoring. Codon optimization provides benefit only in mammalian expression systems, offering no advantage in bacterial or yeast hosts.

Sequence

atggcttccaaggtgtacgaccccgagcaacgcaaacgcatgatcactgggcctcagtggtgggctcgctgcaagcaaatgaacgtgctggactccttcatcaactactatgattccgagaagcacgccgagaacgccgtgatttttctgcatggtaacgctgcctccagctacctgtggaggcacgtcgtgcctcacatcgagcccgtggctagatgcatcatccctgatctgatcggaatgggtaagtccggcaagagcgggaatggctcatatcgcctcctggatcactacaagtacctcaccgcttggttcgagctgctgaaccttccaaagaaaatcatctttgtgggccacgactggggggcttgtctggcctttcactactcctacgagcaccaagacaagatcaaggccatcgtccatgctgagagtgtcgtggacgtgatcgagtcctgggacgagtggcctgacatcgaggaggatatcgccctgatcaagagcgaagagggcgagaaaatggtgcttgagaataacttcttcgtcgagaccatgctcccaagcaagatcatgcggaaactggagcctgaggagttcgctgcctacctggagccattcaaggagaagggcgaggttagacggcctaccctctcctggcctcgcgagatccctctcgttaagggaggcaagcccgacgtcgtccagattgtccgcaactacaacgcctaccttcgggccagcgacgatctgcctaagatgttcatcgagtccgaccctgggttcttttccaacgctattgtcgagggagctaagaagttccctaacaccgagttcgtgaaggtgaagggcctccacttcagccaggaggacgctccagatgaaatgggtaagtacatcaagagcttcgtggagcgcgtgctgaagaacgagcagtaa

You must be signed in to view the full sequence.

References

Lorenz et al. (1991). Isolation and expression of a cDNA encoding Renilla reniformis luciferase. Proc Natl Acad Sci USA - Lorenz 1991 Renilla Luciferase
Zhao et al. (2005). Emission spectra of bioluminescent reporters and interaction with mammalian tissue determine the sensitivity of detection in vivo. J Biomed Opt - Zhao 2005 Luciferase Spectra