Firefly luciferase (FLuc)

Classic ATP-dependent bioluminescent enzyme from Photinus pyralis with yellow-green emission (560 nm) that catalyzes oxidation of D-luciferin. Most widely used reporter gene in molecular biology for transcriptional assays, ATP detection, and in vivo imaging with flash-type kinetics and strong temperature-dependent spectral shift to 612 nm at 37°C.

Length: 1653 bp(551 aa)

Emission: 560 nm

Substrate: D-luciferin

Brightness: High

Signal duration: Flash (<1 min)

Origin: Photinus pyralis

Characteristics

61 kDa protein (550 amino acids) composed of N-terminal and C-terminal domains connected by flexible hinge. Catalyzes two-step reaction: luciferin adenylation by MgATP followed by oxidative decarboxylation producing excited oxyluciferin. Emission spectrum temperature-dependent with 34 nm red shift from 578 nm (25°C) to 612 nm (37°C), increasing fraction above 600 nm from 41% to 64%. Activity increases 1.9-fold at physiological temperature. Requires continuous ATP supply for sustained luminescence. Exhibits bifunctional activity as both luciferase and long-chain fatty acyl-CoA synthetase. Optimum pH 7.8 with Km for ATP in low micromolar range.

Applications: Standard reporter gene for transcriptional regulation studies and promoter activity assays in mammalian cells. ATP quantification in cell viability assays with detection sensitivity down to 0.02 pg. Real-time monitoring of cellular ATP levels and metabolic state. In vivo bioluminescence imaging of tumor growth, metastasis, and therapeutic response in mouse models. Dual-luciferase assays combined with Renilla luciferase for normalized reporter measurements. Protein-protein interaction studies and protein localization tracking. High-throughput screening of drug candidates and compound libraries.

Limitations: Flash-type kinetics with rapid signal decay requires continuous ATP availability or substrate injection for stable measurements. Yellow-green emission (560 nm at 25°C) experiences moderate tissue attenuation in deep tissue imaging, though 37°C red shift to 612 nm improves penetration. Requires cell lysis for standard assays, preventing real-time longitudinal monitoring in the same cells. D-luciferin substrate crosses blood-brain barrier but requires i.p. injection for in vivo imaging. Product inhibition by oxyluciferin at high concentrations. Temperature sensitivity affects quantitative comparisons between in vitro and in vivo conditions.

Sequence

atggaagacgccaaaaacataaagaaaggcccggcgccattctatccgctagaggatggaaccgctggagagcaactgcataaggctatgaagagatacgccctggttcctggaacaattgcttttacagatgcacatatcgaggtgaacatcacgtacgcggaatacttcgaaatgtccgttcggttggcagaagctatgaaacgatatgggctgaatacaaatcacagaatcgtcgtatgcagtgaaaactctcttcaattctttatgccggtgttgggcgcgttatttatcggagttgcagttgcgcccgcgaacgacatttataatgaacgtgaattgctcaacagtatgaacatttcgcagcctaccgtagtgtttgtttccaaaaaggggttgcaaaaaattttgaacgtgcaaaaaaaattaccaataatccagaaaattattatcatggattctaaaacggattaccagggatttcagtcgatgtacacgttcgtcacatctcatctacctcccggttttaatgaatacgattttgtaccagagtcctttgatcgtgacaaaacaattgcactgataatgaactcctctggatctactgggttacctaagggtgtggcccttccgcatagaactgcctgcgtcagattctcgcatgccagagatcctatttttggcaatcaaatcattccggatactgcgattttaagtgttgttccattccatcacggttttggaatgtttactacactcggatatttgatatgtggatttcgagtcgtcttaatgtatagatttgaagaagagctgtttttacgatcccttcaggattacaaaattcaaagtgcgttgctagtaccaaccctattttcattcttcgccaaaagcactctgattgacaaatacgatttatctaatttacacgaaattgcttctgggggcgcacctctttcgaaagaagtcggggaagcggttgcaaaacgcttccatcttccagggatacgacaaggatatgggctcactgagactacatcagctattctgattacacccgagggggatgataaaccgggcgcggtcggtaaagttgttccattttttgaagcgaaggttgtggatctggataccgggaaaacgctgggcgttaatcagagaggcgaattatgtgtcagaggacctatgattatgtccggttatgtaaacaatccggaagcgaccaacgccttgattgacaaggatggatggctacattctggagacatagcttactgggacgaagacgaacacttcttcatagttgaccgcttgaagtctttaattaaatacaaaggataccaggtggcccccgctgaattggagtcgatattgttacaacaccccaacatcttcgacgcgggcgtggcaggtcttcccgacgatgacgccggtgaacttcccgccgccgttgttgttttggagcacggaaagacgatgacggaaaaagagatcgtggattacgtcgccagtcaagtaacaaccgcgaaaaagttgcgcggaggagttgtgtttgtggacgaagtaccgaaaggtcttaccggaaaactcgacgcaagaaaaatcagagagatcctcataaaggccaagaagggcggaaagtccaaattgtaa

You must be signed in to view the full sequence.

References

Zhao et al. (2005). Emission spectra of bioluminescent reporters and interaction with mammalian tissue determine the sensitivity of detection in vivo. J Biomed Opt - Zhao 2005 Luciferase Spectra